|
Tender For Procurement &Amp Establishment Of Lab Equipments And Consumable Items - Uv VisSpectrophotometer Analytical Balance 0.1mg Analytical Balance 1mg Micropipette variable Volume Micropipette Multichannel Digital Compact Balance PH Meter Thermometer Hot Air Oven 250C Hot Air Oven 300C Rotary Shaker Vortex Mixer Muffle Furnace 1200C Digital Hot Plate with magnetic Stirrer SS Top Digital Hot Plate with magnetic Stirrer ceramic Top Tissue Humanizer BinocularMicroscope Inverted Microscope with camera & Computer Ultra Sonicator 5 lit Ultra Sonicator 1.5 lit Water bath 20 lit Water bath 12 lit Deep Freezer Laboratory Deep fridge Ultra Low Temperature Lab Refrigerator Nucleic acid extraction instrument PCR Thermal Cycler Fluorometer RT PCR Fluorescence Microscope Dry bath Temp Controlled water bath Micro centrifuge Water Distillation Incubator Refrigerated Centrifuge Vacuum Pump Anthropology Measurement Tools & Kits UV Case Digital Vertical Autoclave Hot Plate Microtome Heating Mantel 500ml. Heating Mantel 2000 lit PCR cabinet Lab Shaker Handheld UV Light Gel electrophoresis system Stereomicroscope Basic DNA Sequencer Balance for weighing up to 100Kg sieve shaker complete setup Digital Vernier callipers Digital Tong tester Digital SLR camera. Multi-meter Digital micrometre Hammer Digital Centrifuge Extractor Glassware Beaker 1000ml BCG Beaker 100ml BCG Beaker 2000ml BCG Beaker 250ml Cap. BCG Beaker 500ml Cap. BCG Beaker 50ml BCG Burette 50ml. BCG Conical Flask 1000ml. BCG Conical Flask 250ml. BCG Conical Flask 500ml. BCG Conical Flask 50ml. BCG Conical Flask 100ml. BCG Desiccator 100mm. Vacuum BCG Dropper Glass 150mm with teat Dropper glass 200mm with teat Dropper glass 250mm with special Teets Filtration Assembly (500ml.) Flat Bottom Flask 250 ml BCG Funnel 150 mm. BCG Funnel 75mm. BCG Glass Rod with fused ends Measuring Cylinder 1000ml. BCG Measuring Cylinder 100ml. BCG Measuring Cylinder 10ml. BCG Measuring Cylinder 250ml. BCG 25 26 Measuring Cylinder 25ml. BCG Measuring Cylinder 500ml. BCG 27 Measuring Cylinder 50ml. BCG 28 Pipette Volumetric 25ml BCG 29 Pipette Graduated 5 ml BCG 30 Reagent Bottle 1000ml. Glass WMF5 31 Reagent Bottle 250ml. Amber Glass NMFS 32 Reagent Bottle 250ml. Amber Glass WMFS 33 34 Reagent Bottle 250ml. Glass NMFS 35 Reagent Bottle 250ml. Glass WMFS 36 Reagent Bottle 500ml glass NMFS 37 Reagent Bottle 500ml glass WMFS 38 39 Round Bottom Flask 250 ml BCG Round Bottom Flask 500 ml BCG 40 Test Tube 150x18 BCG 41 Test Tube 125x15 BCG 42 TLC Chamber BCG 43 Test tube Graduated with stopper 30ml. BCG 44 Test tube Graduated with stopper 50ml. BCG Lab Accessories 1 Aspirator Bottle 10 Lit cap poly 2. Aspirator Bottle 5 lit cap Poly 3 Bottle Brush 4 Burette Brush 5 Burette Stand Poly with fisher clamp poly 6. Filter paper No. 1, 125mm dia Whatman Pkt 7 Lab Charts 8 Measuring Jug 2. Lit Poly 9 Micro Pipette stand 10 Nitrile Gloves (Pack of 100) 11 Pair of Tongs S5 12 Pipette Stand 13 UV Safety Goggle 14 Alumina Boat 15 Silica Crucible 15 ml 16 Spatula Stainless Steel 15cms Long 17 Sticker Self Sticking Sheet 18 Test Tube Brush 19 Test Tube Holder Brass 20 Test Tube Stand 21 Thermometer 110C 22 Thermometer 360 Degree 23 Three Figer Clamp & Bose Head 24 Tripod Stand 200mm 25 Wash bottle 500ml. Poly 26 Wire Gauge Special Quality 27 Forceps 75 mm Pointed SS 28 Forceps 100 mm Blunt SS 29 Micro Centrifuge Tube 1.5ml, Pkt of 500pcs 30 Micro Centrifuge Tube 2ml, Pkt Of 500 Pcs 31 Micro tips Mix sizes 32 Micro Tip Box 0.2-10ul 33 Micro Tip Box 200-1000ul 34 UV Face Shield 35 Rubber tubing 36 Pipette Pump 37 Rubber Bulb 38 Funnel Holder Double 39 Micro Test Plate Box Chemicals & Kits 1 Forensic study kits (Dried Blood, Semen, Bone, Saliva, Skin) 2 Thin Layer Chromatography Teaching Kit (with TLC chamber) 3 PCR Kits 4 DNA Purification & Extraction Kit 5 Kozelka Hine Apparatus 6 Organic Solvent 7 lodine 125ml. 8 Methanol 2.5 Lit 9 Acetone 2.5 Lit 10 Silver Nitrate 1000gm Ninhydrin 25gm Iso propyl Alcohol 2.5 Lit Phenol 500ml. Chloroform 500ml SDS 500gm Tris Buffer 100GM Hydrogen Peroxide 5 Lit Xylene 2.5 lit Sulphuric Acid 5 lit Nitric Acid 5 Lit Hydrochloric Acid 5 lit Formaldehyde 2.5 lit Forensic Buffer 500ml. 1M Sodium Chloride 250ml. Stain Extraction Buffer 500ml. Polyvinylidene fluoride (PVDF) Poly(methyl methacrylate) (PMMA) Polyvinyl chloride (alternatively: poly(vinyl chloride) (PVC) Polyimide Polysulfone (PSF) Nickel oxide nanoparticle ZrO2 nanoparticles Titania nanoparticles Dichloromethane Benzene Acetone Tissue roll Silver foil(5 meter) Multi-meter (Digital) Tool kit box Solder Iron kit Dielectric Measurement Thermoluminescence Photoluminescence Desiccator with vacuum pump Physical Science-Chemistry LabChemicals Items Ferric Chloride (FeCl3) anhydrous Phenolphthalein CTAB (Cetyltrimethyl ammonium bromide) DS (Dodecyl Sulfate) Activated Charcoal Sodium Benedict Solution Polyvinyl Alcohol Polystyrene Methyl Acrylate Glucose Acetonitrile Sodium Nitrate Sodium Nitrite Sodium bicarbonate Sodium Carbonate Diethyl ether Fructose Methylene blue Nitroprusside solution Biurate reagent Milon reagent Chlorine water 2,4 dinitrophenyl hydrazine Schiff Reagent Carbon disulfide Zn dust 2,4-dinitrophenol chlorobenzene Diphenylamine Phenol m-dinitrobenzene Anthracene Citric acid Iron sulfate Iron chloride II Iron chloride III Ethylene di amine Zeolite Na-Y Thio actamide Indium Sulfate TugstunSulfide Selenium powder Congo Red dye Crystal violet dye Rhodamine B dye Basic Blue dye Graphite powder Alizarin yellow dye Orange G dye Phenyl 1,2 diamine Heavy Metal ions (As, Cd, Cr, Pb, Hg, Ni, Cu) Malachite green dye Sodium Tugstun Barfoed reagent Seliwanoff reagent Potassium lodide Tertiary Butanol Benzoquinone MoSe WS Carbon Nano Tubes Activated Carbon Powder MCM-41 Maltose Ninhydrin Silicotugstic acid Life Science-Zoology Lab Chemicals Item (i) Consumable ALPHA NAPTHOL 2,7 DICHLOROFLUORESCEIN ΑΜΙΝΟ ΝΑΡΗTHOSULPHIONIC ACID AMMONIUM SULPHATE AMONIUM MOLYBDATE ANTHRONE REAGENT BENZENE BORIC ACID CONC. H2SO4 CONC.HCL COPPER ACETATE COPPER SULPHATE DI ISO BUTYLE KETONE ETHANOLIC SODIUM ETHYL ETHER FOLIN CLOCALTEAU REGENT GALACIAL ACITIC ACID KCL KOH METHANOL NAOH ORCINOL PER CHLORIC ACETIC ACID PETROLIUM ETHER PHENOLPHATHALIN (1% ETHANOLIC SOLUTION) POTASIUM BI SULPHATE POTASSIUM BOROHYDRIDE POTASSIUM IODIDE RESORCINOL SELENIUM DIOXIDE POWDER SILICA GEL SODIUM BI SULPHITE SODIUM CARBONATE SODIUM CITRATE SODIUM POTASSIUM TARTRATE SODIUM SILICATE TRI CHLORO ACETIC ACID BENZENE TRI METHYL AMMONIUM HYDRIED CUSO4 DINITROBANZENE FERIC CHLORIDE 44 HEXANE 45 K2504 46 MANGANESE SULPHATE 47 MOLYBDATE SOLUTION 48 POTASSIUM CHROMATE 49 POTASSIUM DI CHROMATE 50 POTASSIUM META BI SULPHITE 51 SILVER NITRATE 52 SODIUM BENZOATE 53 SODIUM BISMUTHATE 55 SODIUM THIOSULPHATE (HYPO) 56 STARCH 57 VITAMIN A ACETATE 59 BORAX CARAMINE STAIN 61 METHYL CELLULOSE 62 SODIUM CARBO METHYL CELLULOSE 63 NICKLE SULPHATE 64 EHARLICH'S HAEMATO XYLINE 69 BORAX 70 CARAMINE 1 2 3 4 5 (ii) Consumable Taq DNA Polymerase (3 U/ul) (Includes Enzyme: 1 vial; 10X Taq Buffer E: 4 vials), 1000Units - PI No. MME29J dNTP Mix, 10 mM (2.5 mM each), 4 x 1000 µl - Pl No. FC24J Agarose for Nucleic Acid Electrophoresis-100g-PI No. AGEI Water (DNase, RNase Free), 5 x 100 ml-PI- No. FC41J Ethidium Bromide, 10 mg- PI FC38 6 Proteinase K, Solution, 5 X 1 ml (20 mg/ml) - PI No. PK2L 7 8 9 StepUp™ 100 bp DNA Ladder, 100 µg-Pl No. MBD13] StepUp™ 1 kb DNA Ladder, 50 µg-Pl No. MBD20 Ammonium persulphate (bulk pack), 10 g-PI No. ER118 10 TRIS hydrochloride Piperazine hexahydrate, Hi-LRM 12 Agar powder, Bacteriological grade 13 L-Tryptophan 14 YPD Broth (YEPD Broth) 15 Yeast Mannitol Agar w/ Congo Red 16 Verso cDNA Synthesis Kit -40 reactions 17 Casamino Acid for bacteriology Sr. No. Item Description 1 MICRO TIPS-Capacity 0.2-10 µl 2 MICRO TIPS-Capacity-2-200 µl 3 MICRO TIPS-Capacity 200-1000 με 4 Micro Centrifuge Tube-Capacity 1.5 ml (iv) Consumable Sr. No. Item Description 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 Pepsin (powder, 2400 units/mg protein) Pancreatin (8 USP specifications). Amyloglucosidase from Aspergillus niger (lyophilized powder, 30-60 units/mg protein (biuret), ≤0.02% glucose) Whatman Filter Number-3 DNase I (RNase Free), 1000Units-PI-FC56 RNaseA (DNase free), 10 mg-PI-FC25S GeNei™ InSite PCR-Based Site Directed Mutagenesis Kit, 10 reactions Resazurin sodium, Hi-Cert™ Yeast Nitrogen Base Ammonium Ceric Nitrate McFarland standard set (Each set contains 1 tube of 0.5, 1, 2, 3, 4 McFarland standard) Bismuth(111)subnitrate, Hi-ARTM Folin &ciocalteu's phenol reagent, Hi-LRM Butylated hydroxytoluene (+)-a-Tocopherol, liquid Potassium persulphate, Hi-ARM/ACS Quercetin dihydrate 2,2-Diphenyl-1-picrylhydrazyl Butylated hydroxyanisole Hexane Fraction from Petroleum Methanol AR/ACS 10mM 2,4,6 6-tri(2-pyridyl-1,3,5-triazine (TPTZ) 1 2 3 Murashige & Skoog Medium w/ Vitamins & Sucrose; w/o CaCl2 & Agar Sodium azide 6M Guanidine HCL (Vi) Consumable Sr. No. 1 2 3 4 5 6 7 8 9 10 Item Description AGA GTT TGA TCM TGG CTC AG GGT TAC CTT GTT ACG ACTT TAA AAC TYA AAK GAA TTG ACG GG ACT GCT GCS YCC CGT AGG AGT CT GTAGTCATATGCTTGTCTC TCCGCAGGTTCACCTACGGA CGCTGCGTTCTTCATCG TCGATGAAGAACGCAGCG TCC GTA GGT GAA CCT GCG G TCC TCC GCT TAT TGA TAT GC 11 CATTATTCTCACATGGAATCTAACC 12 GAGGACAAATATCATTCTGAGGAGC 13 GCTCCTCAGAATGATATTTGTOCTC 14 ACCCAGACAACTACACOCCAGCAA 15 TTACTGGGGTGTAGTTGTCTGGGT 16 CTOCTTTTCTGGTTTACAAGACCAG 17 TACAGTCTAATGCTTCACTCAGOCA 18 GTACCGCTAATAATTGGTGCTCC 19 GGGGCAATTATTAGGGGAACTAGTCA 20 CAACACTTGTTCTGATTCTTCGG 21 22 GGGTGGCCAAAGAATCAGAACAAGTG GGGGGTTCGATTCCTTCCTTTC Life Science-Botany Lab Chemicals Item Description Murashige and Skoog's Medium Muller Hilton agar Potato Dextrose Agar Sabouraud dextrose agar Methanol Fehling Solution 1 Fehling Solution 2 Benedict solution Growth hormone-2,4-D Growth hormone-IBA Growth hormone-NAA Growth hormone-BAP Soil estimation kit Bactiriological biochemical kit NA agar Ninhydrin solution Gram's staining kit Lactose broth Eosine indicator Yeast ext. Menitol agar Allythiouria Indole, MR, VP urease, citrate Soil testing kit for Macronutrients Biochemical Test Kit Methylene blue Benedicts solution itraconazole Ampicillin antibiotics gentamycin, Kanamycin Phenol red Giemsa Staining Spore saining kit Antibiotic docs vancomycin, streptomycin Streptomycin gentamycin, Tetracycline, ampicillin azithromycin Butyl Alcohol Osmic Acid Ammonium hydroxide Gram's lodine Mortar and pestle Sprite Cotton Tissue paper Litmus paper Sudan 4th Percoll Bovine serum albumin Mannitol MES-KOH Cellulose Pectolyase Disruption buffer Tris-HCI BSA 0 DTT MOPS-KOH Glycine Nicotinic acid Pyrodixine-HCL Myo-inosital Fe-versenate Acid fuchsin reagent Bromophenol reagent Butyl Alcohol Geographical Maps, Sheets and Atlas Sr. no. 1 Description World map Thermally Laminated : Physical Political 2 Asia map Thermally Laminated : Physical Political 3. India map Thermally Laminated : Physical Political 4. Rajasthan map Thermally laminated : Physical Political 5 Continents map Thermally Laminated 6. 7 Visual 3D Maps Of World Physical Visual 3D Maps Of Indian Subcontinent Physical 8 3D raised Relief Maps of Asia 9 3D raised Relief Maps of India B. Sr по 1 2 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. Geographical Charts Description Solar System Solar, Lunar Eclipses & Tides Distribution of Earth Quakes Distribution of Volcanoes Activities of volcanoes Rivers & Their Geological Actions Continental Drift Type of Flods Attitudes Assumed by an Axial Plane & an Axis of Folds Description of Flods Structure of the earth and Isostasy Description & Classification of Faults Unconformity structure Forms of Igneous Rocks Structural Features of Rocks 16. Lineation 17. 18 19 20 21 22 23 Mountain Building Glaciers Star Life cycle Latitude & Longitude Geological time cycle Atmosphere-Layers Water Cycle 24 Seasons 25 Carbon Cycle C. Geography Lab Equipment's and Apparatus 1. Weather Instruments Sr. Description 1 Rain Gauge 2 Digital Anemometer In-Built temper fan Low Power C indication Data Hold and Selectable °C/ Auto Power Of Range of Wind with an accurac 3. Barometer Dial Type Weather Hyt 5. Thermometer (Maximum and minimum) Wide Digital Dis Thermometer with 6. Simple thermometer Wide Digital Din Thermom 2. Field Survey and Project Requirements St. Description Specificat 1 Plane Table set Plane Table Board 750x600x22mm wood. Comers of the board shoule metallic comers (As per Survey of India Pattern) Heavy Plate head with thick brass metal fittings. Aluminum Telescopic Stand duly Packed on a witomooof.cover Dumpy Level Prismatic Compass Theodolite Abney Level Indian Clinometer Spirit Level Tape glass fiber Survey Chart Ranging Rod Arrows Trough Compass Hand held GPS with rechargeable batteries with Chart plotter quality -Binocular Rock specimen set of 50 Photogrammetry Instruments for practical Sr. по. Description 1 Pocket stereoscope Instra 2 Mirror stereoscope Magna Win binoc 3 Glass Marking Pencil
|
